Index: A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Home > Hairpin loop

A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop.

An example of a 5' → 3' sequence of RNA which would lead to a hairpin loop structure is:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC

The above sequence is an example of dyad symmetry, where the bases downstream are complementary to the bases upstream and so they form base pairs.

Hairpin loops are important in prokaryotic transcription termination. The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination.

<Hide>

Topics: Hairpin Loop, Hairpin (genetics), Hairpin Turn...

HairpinThe word hairpin may refer to: a blunt needle in the form of a narrow U to fix hair into position hairpin turn hairpin (genetics) the symbol used to denote crescendo/decrescendo in music; see dynamics (music).	Hairpin (genetics)There are other meanings of hairpin In genetics, a hairpin is a part of single-stranded DNA, usually a palindromic sequence, that aligns with itself to form a needle-like structure. A single-stranded DNA like CCTGCXXXXXXXGCAGG becomes C G C G T A G C C G	Hairpin turnA nearly 180-degree turn in a road, trail, or ramp is called a hairpin turn (also hairpin bend or, if in a trail, a switchback . It is named for its geometric resemblance to a hairpin. These turns are often built when a route climbs up or down a steep slo
Hairpin loopA hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop. An example of a 5' → 3' sequence of RNA which would lead to a

Non User